Terminator

Part:BBa_K2560035:Design

Designed by: Tobias Hensel   Group: iGEM18_Marburg   (2018-09-15)


Phytobrick version of BBa_B0015

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

This part was created by polymerase chain reaction (PCR) on the template BBa_J23102 and subsequent integration into the part entry vector BBa_K2560002 using Golden Gate assembly.

Forward oligo: AACGTCTCGCTCGGCTTAACCAGGCATCAAATAAAACGAAAGGC

Reverse Oligo: TTCGTCTCCCTCAAGCGTATAAACGCAGAAAGGCCCACCC