Regulatory

Part:BBa_K2560019:Design

Designed by: Tobias Hensel   Group: iGEM18_Marburg   (2018-09-13)


Phytobrick version of BBa_J23103

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 7
    Illegal NheI site found at 30
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

The sequence was obtained from part BBa_J23103. The parts sequence was not changed apart from adding the promoter overhangs that are required for subsequent cloning.

Source

The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector BBa_K2560002 using Golden Gate assembly. If you stuggle with de novo synthesis we recomended this site.

Forward Oligo: CTCGGGAGCTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCTACT

Reverse Oligo: CTCAAGTAGCTAGCATAATCCCTAGGACTGAGCTAGCTATCAGCTCC

References