RBS

Part:BBa_K2560010:Design

Designed by: Tobias Hensel   Group: iGEM18_Marburg   (2018-08-21)


Phytobrick version of BBa_B0032

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

The sequence was obtained from part BBa_B0032. The parts sequence was not changed apart from adding the RBS overhangs that are required for subsequent cloning.

Source

The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector BBa_K2560002 using Golden Gate assembly. If you stuggle with de novo synthesis we recomended this site.

Forward Oligo: CTCGTACTAGAGTCACACAGGAAAGTAATCAATG

Reverse Oligo: CTCACATTGATTACTTTCCTGTGTGACTCTAGTA

References