Coding

Part:BBa_K2273017:Design

Designed by: Merle Brügmann   Group: iGEM17_TU_Dresden   (2017-10-02)

Minimal SpyCatcher codon optimized for Bacillus subtilis with His Tag

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Design

This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

Prefix with EcoRI, NotI, XbaI, NgoMIV and SD GAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGGCCGGC
Suffix with AgeI, SpeI, NotI and PstI ACCGGTTAATACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red and AgeI and NgoMIV in orange. Additionally, the Shine-Dalgarno sequence is marked in silver and the start and stop codon is underlined.)


Source

The His Tag was added to the sequence via PCR with BioBrick BBa_K2273015 as a template using the primers listed below.

Biobrick_prefix_fwd gatcGAATTCgcggccgcTTCTAGA
miniCatcher_RFC25_His_rev gatcTCTGCAGCGGCCGCTACTAGTAttaaccggtGTGATGATGGTGGTGATGCCCGTTCACGGTGACCTGC

Following amplification, the signal peptide was digested using EcoRI and PstI and ligated into pSB1C3.