Coding
LipA

Part:BBa_K2273008:Design

Designed by: Jonathan Hammer   Group: iGEM17_TU_Dresden   (2017-09-26)

LipA signal peptide of B. subtilis lipoic acid synthase

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

This part was designed by Olga Mitrofanova.

Design

This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

Prefix with EcoRI, NotI, XbaI and SD GAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAA
Suffix with AgeI, SpeI, NotI and PstI ACCGGTTAATACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red and AgeI in orange. Additionally, the Shine-Dalgarno sequence is marked in silver and the stop codon is underlined.)

This part was designed to meet the needs of the Signal Peptide Toolbox which was created by the iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!).

Source

The LipA signal peptide of B. subtilis lipoic acid synthase was amplified via PCR from the B. subtilis wild type W168 genome using the primers listed below.

LipA/(estA)_SP fwd gatcGAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGAAATTTGTAAAAAGAAGGATC
LipA/(estA)_SP rev gatcTCTGCAGCGGCCGCTACTAGTAttaaccggtAGCGGCTTTTGCTGACGGCTG

Following amplification, the signal peptide was digested using EcoRI and PstI and ligated into pSB1C3.

References

Ulf Brockmeier, Michael Caspers, Roland Freudl, Alexander Jockwer, Thomas Noll and Thorsten Eggert "Systematic Screening of All Signal Peptides from Bacillus subtilis: A Powerful Strategy in Optimizing Heterologous Protein Secretion in Gram-positive Bacteria" Journal of Molecular Biology 362 (2006): 393-402. PubMed

Jan Maarten van Dijl and Michael Hecker "Bacillus subtilis: from soil bacterium to super-secreting cell factory" Microbial Cell Factories 12:3 (2013): 1-6. PubMed

Ling lin Fu, Zi Rong Xu, Wei Fen Li, Jiang Bing Shuai, Ping Lu, Chun Xia Hu "Protein secretion pathways in Bacillus subtilis: Implication for optimization heterologous protein secretion" Biotechnology Advances 25 (2007): 1-12. PubMed