Coding

Part:BBa_K200030:Design

Designed by: James Chappell   Group: iGEM09_Imperial College London   (2010-09-20)

Lipase A from B.subtilis

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 726
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

Lipase A was amplified from the B.subtilis genome 168 by polymerase chain reaction (PCR) using the following primers:

Fwd = GCTCTAGAGATGCAAATGACGGAAGCTACCTG Rev = CTGCAGCGGCCGCTACTAGTATTATTAACTTGATGTAATCATTGCG

Source

Lipase A from B.subtilis

References