Regulatory

Part:BBa_K1104201:Design

Designed by: Ting-Yun Chiang   Group: iGEM13_NYMU-Taipei   (2013-09-11)

TrxC promoter


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

Primers For PCR

TrxCp_FP gct tctagag ccaaagcctgcgactatcatacct
TrxCp_RP gga ctgcag cggccgct actagt a aacgacgccggtatgtttctaatatgt

PCR Time Protocol

Temperature(°C) Time(sec) Number of Cycles
94 120 --
94 15 35
53 30
72 20
72 300 --

Source

References

  1. D'Autréaux, B., & Toledano, M. B. (October 01, 2007). ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nature Reviews Molecular Cell Biology, 8, 10, 813-824.
  2. Ritz, D. (January 28, 2000). Thioredoxin 2 Is Involved in the Oxidative Stress Response in Escherichia coli. Journal of Biological Chemistry, 275, 4, 2505-2512.
  3. Ecocyc.