Plasmid_Backbone

Part:BBa_J61002:Design

Designed by: John Anderson   Group: Arkin Lab   (2006-07-31)


EX-Ptet-S-rbsRFP-P "RFP reporter"

Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2927
    Illegal XbaI site found at 2942
    Illegal SpeI site found at 2
    Illegal PstI site found at 885
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2927
    Illegal SpeI site found at 2
    Illegal PstI site found at 885
    Illegal NotI site found at 878
    Illegal NotI site found at 2933
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2927
  • 23
    INCOMPATIBLE WITH RFC[23]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2927
    Illegal XbaI site found at 2942
    Illegal SpeI site found at 2
    Illegal PstI site found at 885
  • 25
    INCOMPATIBLE WITH RFC[25]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2927
    Illegal XbaI site found at 2942
    Illegal SpeI site found at 2
    Illegal PstI site found at 885
    Illegal AgeI site found at 581
    Illegal AgeI site found at 693
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal BsaI.rc site found at 1966
    Illegal EcoRI site found at 2927
    Illegal XbaI site found at 2942
    Illegal SpeI site found at 2
    Illegal PstI site found at 885


Design Notes

N/A


Source

PCR ca1020F/R on pSB1A2-I13521 (900bp, SpeI/PstI)

Sub into pSB1A2-I13522 (SpeI/PstI)

Product is pBca1020, will be an iGEM number ultimately


ca1020F Forward SpeI oligo for X-rbsRFP-P plasmid

gcactACTAGTgaaagaggagaaatactagatggc

ca1020R Reverse PstI oligo for X-rbsRFP-P plasmid

ccggactgcagcggccgcttctagtatataaacg


References