PBAD SPL
Description
This is a page containing a synthetic promoter library (SPL) of pBAD promoters made by 2013 DTU iGEM team. The library can be used to make and arabinose inducible system with very low leakiness, or tune the the promoter strength of the system when it's turned on.
A tight inducible system can be a very useful tool to express lethal or growth inhibiting proteins in E.coli. It can also be necessary with a non leaky expression system if you would like to visualize the expression of GFP SF in E.coli (see link).
The library
Here is a complete list of the sequences and their relative leakiness and strength:
| Identifier | Sequencea | Induced Strength | Leakiness | Inducibilityb | ||
|---|---|---|---|---|---|---|
| Col. 02 | CTGACGACGCCCCTCTCCGCCCCTTAAAATGTCCA | 14.2 | 0.203 | 69.9 | ||
| Col. 03 | CTGACGTAATCATACCGCCGAAAGTATTATCATTA | 16.6 | 0.426 | 39 | ||
| Col. 04 | CTGACGCGACAACATTGCGTCCTATAAAATGCCGA | 14.2 | 0.345 | 41 | ||
| Col. 05 | CTGACGGCCCGCCCCCGATGCGCATAAAATACCAA | 17.7 | 0.424 | 41.6 | ||
| Col. 12 | CTGACGCGTATCGCGAGCGGGCGTTATTATACGCA | 13.6 | 0.414 | 32.9 | ||
| Col. 10 | CTGACGCCCCGAATCAGTAGTATTTATTATCTAGA | 18 | 0.462 | 38.8 | ||
| Col. 09 | CTGACGCCACCCCCCCCCCCGGCGTATAATTCCCA | 16.1 | 0.530 | 30.4 | ||
| Col. 08 | CTGACGCCCTACCGCTCGCCCCCCTATTATACCCA | 13.4 | 0.211 | 63.4 | ||
| Col. 13 | CTGACGCCCCCCCCGTCCACCCCCTAATATCCCGA | 10.9 | 0.096 | 113.6 | ||
| Col. 15 | CTGACGTGCGCCTGCCGTCCAAAGTAATATCCTTA | 15.5 | 0.235 | 65.8 | ||
| Col. 18 | CTGACGCCCCGAATCAGTAGTATTTATTATCTAGA | 19.8 | 0.524 | 37.8 | ||
| Col. 19 | CTGACGCTCGCACCGGCGACCCGATAATATCCATA | 18.0 | 0.315 | 57 | ||
| Col. 31 | CTGACGCCCCCCCTCCCCCGACCTAAAATATCCAG | 3.8 | 0.161 | 23.6 | ||
| Col. 29 | CTGACGCCGCTGCACCCGTCCCCCTATTATAGCAA | 14.8 | 0.301 | 49.2 | ||
| Col. 26 | CTGACGCCGATCCTATCTCCCTATTAAAATTTTTA | 13.8 | 0.292 | 47.2 | ||
| Col. 22 | CTGACGCCCCGAATCAGTAGTATTTATTATCTAGA | 16.8 | 0.466 | 36.1 | ||
| Col. 33 | CTGACGCCAGCTTCCTACTTCAAATATAATCCGTA | 14.4 | 1.01 | 14.3 | ||
| Col. 34 | CTGACGTCCCTCTTCCGCGCCCCCTAAAATACCCA | 12.4 | 0.187 | 65.9 | ||
| Col. 35 | CTGACGCCCAACCCGACACAGCGATATAATAATGA | 18.4 | 0.89 | 20.7 | ||
a The sequence of each pBAD promoter characterized. To use this simply produce a primer with the promoter sequence you wish in a tail. Replace the old promoter in your system e.g. Part:BBa_K808000 with the new and see the chance. For more information go to (link).
b Inducibility = Induced Strength divided by leakiness.
Characterization
We did a characterization by running growth experiments in parallel on a BioLector (see more). Below diagram sums up our results:
Conclusion
The pBAD SPL contain promoters to the arabinose inducible system that will enable low leakiness but still maintain a reasonable promoter strength when turned on. This verifies that the SPL standard (RFC 63) also can be used to produce promoters for inducible systems.