Help:BioBrick Primers


The following is a list of primers that you may find useful for PCR or Sequencing when dealing with BioBrick parts.

Prefix-F and Suffix-R Primers

These primers are useful for:

  • PCRing the BioBrick insert

Note: Do not use for sequencing the BioBrick insert, as it will not cover the beginning/ends of the part. Do not use these primers for adding the BioBrick prefix and suffix to a new part.

Prefix-F - 5' GAATTCGCGGCCGCTTCTAG 3' - The primer binds to the prefix of BioBrick parts. The primer moves forward and will read into the BioBrick insert. This primer will also work for the prefix of coding region parts.

Suffix-R - 5' CTGCAGCGGCCGCTACTAGTA 3' - The primer binds to the suffix of BioBrick parts. The primer moves reverse and will read into the BioBrick insert.


VF2 and VR Primers

All BioBrick plasmids should have VF2 (BBa_G00100 and VR (BBa_G00101) binding sites. These binding sites are far enough from the BioBrick prefix and suffix that they should be able to adequately cover those areas when sequencing.

These primers are useful for:

  • Sequencing the ends of the plasmid backbone (BioBrick prefix and suffix)
  • Sequencing the BioBrick insert
  • PCRing the BioBrick insert

VF2 - 5' TGCCACCTGACGTCTAAGAA 3' - The VF2 primer binds to the VF2 site on BioBrick plasmid backbones. The primer moves forward and will cover the BioBrick prefix and the insert.

VR - 5' ATTACCGCCTTTGAGTGAGC 3' - The VR primer binds to the VR site on BioBrick plasmid backbones. The primer moves reverse and will cover the BioBrick suffix and the insert.


Prefix-R and Suffix-F Primers

These primers are useful for:

  • Sequencing into the BioBrick plasmid
  • PCRing the BioBrick plasmid (we recommend using our linearized plasmid backbone primers instead)

Suffix-F - 5' ACTAGTAGCGGCCGCTGCAG 3' - The primer binds to the suffix of BioBrick plasmid. The primer moves forward and will read into the BioBrick plasmid.

Prefix-R - 5' TCTAGAAGCGGCCGCGAATTC 3' - The primer binds to the prefix of BioBrick parts. The primer moves reverse and will read into the BioBrick insert.

Linearized Plasmid Backbone Primers

These primers are useful for:

SB-prep-3P-1 - 5' GCCGCTGCAGTCCGGCAAAAAA 3' - The primer binds to part of the BioBrick suffix and into the plasmid backbone. The primer moves forward and will read into the BioBrick plasmid.

SB-prep-2Ea - 5' ATGAATTCCAGAAATCATCCTTAGCG 3' - The primer binds to part of the BioBrick prefix and into the plasmid backbone. The primer moves reverse and will read into the BioBrick plasmid.


Internal Plasmid Primers

These primers are useful for:

  • Sequencing inside certain plasmids, since primers like Prefix-R and Suffix-F will not cover the interior

PBB-ior-R - 5' TGACCAAAATCCCTTAACGTG 3' - The primer binds to a region located inbetween the origin (pMB1) and resistance gene of the plasmid. The primer moves reverse and will read into the BioBrick plasmid.

PBB-eoro-F - 5' GCTGAAGCCAGTTACCTTCG 3' - The primer binds to region located inside the origin (close to the end) and into the plasmid backbone. The primer moves forward and will read into the BioBrick plasmid.

Resistance Primers

Ampicillin

PBB-AMPR-F - 5' CAACGTTGTTGCCATTGCT 3' -


PBB-AMPR-Long-R - 5' GCGGCCAACTTACTTCTGAC 3' -

Chloramphenicol

PBB-CMR-F - 5' GGGCGAAGAAGTTGTCCATA 3' - PBB-CMR-Long-F - R' TACACCGTTTTCCATGAGCA 3' -

Kanamycin

PBB-KANR-F - 5' CGCTCGTCATCAAAATCACTC 3' - PBB-KANR-Long-R - 5' GGGAAAACAGCATTCCAGGT 3' -

Tetracycline

PBB-TETR-Long-F - 5' CCTATATCGCCGACATCACC 3' - PBB-TETR-R - 5' CGACTCCTGCATTAGGAAGC 3' -