Collections/Metal

This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.

iGEM Teams and Labs have completed a variety of biosensors and bioremediation projects that involve metal-binding and metal-sensing. Metals that iGEM teams have worked with include: nickel, mercury, lead, arsenic, copper, amongst others.


The collection below includes DNA parts that are responsible for both metal binding and metal sensing.


Previous iGEM Metal Projects

The following table contains iGEM teams that have worked with a variety of metals, along with links to their project wiki and Registry parts. This is not an exhaustive list.

Team Year Parts Project As Au Cd Co Cr Cu Fe Pb Hg Ni Zn
Bielefeld-CeBiTec 2015 Parts Cell-free Sticks - It works on paper na na na na Yes Yes na Yes Yes Yes na
Gaston_Day_School 2015 Parts ~ na na Yes na na na na na na na na
LZU-China 2015 Parts Micro Holmes: —A Novel device for Monitoring Heavy Metal Ions na na na na Yes Yes na na na na na
Nanjing-China 2015 Parts Metallosniper: —innovative total solution for heavy metals na Yes na na na na na Yes na na na
SCUT 2015 Parts Super Cadmium Ion Killer: Engineering E.coli to adsorb cadmium ion during the sewage treatment process na na Yes na na na na na na na na
UMBC-Maryland 2015 Parts Copper Bioremediation Using Genetically Engineered E. Coli na na na na na Yes na na na na na
UMBC-Maryland 2015 Parts Copper Bioremediation Using Genetically Engineered E. Coli na na na na na Yes na na na na na
Berlin 2014 Parts A remote control for E. coli na na na na na na Yes na na na na
BIOSINT Mexico 2014 Parts Green Demon na na na na na na na na Yes na na
Cornell 2014 Parts Lead it go: Heavy metal sequestration from regional contaminated waters using genetically engineered E.coli na na na na na na na Yes Yes Yes na
HUST-China 2014 Parts Warlord E.CaoMengde - a tale of 3 pollutants treatment na na na na na Yes na na na na na
INSA-Lyon 2014 Parts CurLy’on na na na Yes na na na na na Yes na
Minnesota 2014 Parts Mntallica: Engineering Bacteria for Mercury and Heavy Metal Bioremediation na na na na na na na na Yes na na
Nagahama 2014 Parts One E.coli has one function theory na na Yes na na na na na na na na
NEFU China 2014 Parts Nanocrystal E.coli Flocculation Union na na Yes na na na na na na na Yes
Penn 2014 Parts Cadmium recovery by a recombinant Magnetospirillum magneticum AMB-1 na na Yes na na na na na na na na
UFAM Brazil 2014 Parts Mercury Bacter na na na na na na na na Yes na na
York 2014 Parts EcoCADMUS (E. coli CAdmium DecontaMination Universal System) na na Yes na na na na na na na na
Edinburgh 2013 Parts WastED na na na na na na Yes na na na na
Gaston Day School 2013 Parts Fluorescent Detection of Cadmium in Water Supplies na na Yes na na na na na na na na
Gaston Day School 2012 Parts Detection of Heavy Metal Contaminants in Water Yes na Yes na na na na Yes na na na


Metal Binding Proteins

This set includes coding regions (CDS, Translational Units, Protein Domains) for proteins that bind various metal ions.


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K190019fMT 222Nienke Kuipers87393Translational_UnitIn stock
BBa_K205004MerT - Membranous Mercury transporter 351Katelin Haynes1471 CodingIn stock
BBa_K346001RBS (B0034) + MerR (mercury-responsive transcription factor)453Ao Liu & Ying Sheng94589Translational_UnitIn stock
BBa_K519010SmtA171Kotone Miyake69015CodingIn stock
BBa_K1420001merA, mercuric reductase from Serratia marcescens1686Stephen C. Heinsch9690 CodingIn stock
BBa_K1509000Coding for the trans-acting regulator SmtB369Tong Li9533 CodingIn stock
BBa_K1505000RBS+mntH1324Renyao Wei1657 Translational_UnitIn stock
BBa_K1393001OprF(Ala196)+CBP609Jiajun Tan5830 CodingIn stock
BBa_K1342003SmtA Part171Naoki Saito,Daiki Haraguchi,Yoshiharu Otaki,Ryuhei Minei 2880 CodingIn stock
BBa_K1438001Bacterioferritin (BFR) M52H heme-deletion477Johann Bauerfeind4448 CodingIn stock
BBa_K1438002Hu_Ferritin1077Johann Bauerfeind1704 CodingIn stock
BBa_K1420002merB, Organomercurial Lyase from Serratia marcescens639Stephen C. Heinsch110282CodingIn stock
BBa_K1420003MerP, mercuric transport protein periplasmic component276Stephen C. Heinsch6133 CodingIn stock
BBa_K1420005merT, mercuric transport protein351Stephen C. Heinsch5935 CodingIn stock
BBa_K1505002RBS+mntH+mCerulean2034Jane Shmushkis, Amey Vrudhula1989 Translational_UnitIn stock
BBa_K1701000GolB195Wei Wei8781 CodingIn stock
BBa_K1694006 Gold Binding Polypeptide132CHIH-HSUAN HSU59721CodingIn stock
BBa_I721002Lead Binding Protein399Jeffrey Hofmann408910CodingIt's complicated
BBa_K231000Metal binding peptide51Daniel R Tarjan2505 CodingIt's complicated
BBa_K346003RBS(B0032)+MBP(mercury metal binding peptide engineered from MerR)342Huyang Tengxin95631Translational_UnitIt's complicated
BBa_K643000CDS7 cadmium sulfate binding peptide coding sequence71Sung won Lim5446 CodingIt's complicated
BBa_K643002J140 metal binding peptide53Rikki Frenkel, Justin Fabrikant1799 CodingIt's complicated
BBa_K1122666Ferric uptake repressor450Hugo Villanueva24582CodingIt's complicated
BBa_K1122702Ferric ion-binding protein (FbpA)999Harry Thornton5942 CodingIt's complicated
BBa_K1122703Ferric ion-binding protein (FbpA) without a signal peptide936Harry Thornton5474 CodingIt's complicated
BBa_K1438000Bacterioferritin (BFR)513Johann Bauerfeind6909 CodingIt's complicated
BBa_K1393000OprF(Val188)+GS linker+CBP600Jiajun Tan9141 CodingIt's complicated
BBa_K1471000MerE.180Juan No Hernndez Salazar38213CodingIt's complicated
BBa_K1471001MerB.639Jaime Antonio del Castillo Nuez30793CodingIt's complicated
BBa_K1420004merR family transcriptional regulator, regulatory protein for mer operon435Stephen C. Heinsch71682CodingIt's complicated
BBa_K1505001RBS+smtA+mCherry977Renyao Wei2275 Translational_UnitIt's complicated
BBa_K1438035PPMT Sascha Kaufmann1218 CodingNo part sequence
BBa_K1701001PbrR438Wei Wei90821CodingIt's complicated
BBa_K1980000TAT Copper Storage Protein 1 474Sam Garforth8074 CodingIt's complicated
BBa_K1980001TAT Copper Storage Protein 1 sfGFP1203Sam Garforth115441CodingIt's complicated
BBa_K1980003MymT sfGFP912Sam Garforth89591CodingIt's complicated
BBa_K1980002MymT183Sam Garforth87003CodingIt's complicated
BBa_K2127001Inducible High Expression His-Tagged Photosystem II CP47 subunit2071Nafaa Haddou7273 CodingIt's complicated
BBa_K2127002CP47 His-tagged with Lac Promoter1886Dawson Zeng6218 CodingIt's complicated
BBa_K160001Fe-Receptor2244RAUL CUERO1196 CodingNot in stock
BBa_K190020MymT180Nienke Kuipers13084 Translational_UnitNot in stock
BBa_K190021SmtA189Nienke Kuipers18342Translational_UnitNot in stock
BBa_K1438003PPMT_GS_ATPCS1704Johann Bauerfeind1641 CodingNot in stock
BBa_K1550004BmtA (Lead/Zinc-binding metallothionein from Oscillatoria brevis, codon optimized for E. coli)165Jesse Goldenberg20812CodingNot in stock
BBa_K2127004CP-47-HIS TAG1548Mirat Sojitra19872CodingNot in stock


Metal Binding Composite Parts

This set includes composite parts that bind various metal ions.


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K346004RBS(B0034)_MBP(lead metal binding peptide egineered from PbrR)+Terminator(B0015)479Junyi Jiao97953CompositeIn stock
BBa_K1460001pT7 + RBS + GST (glutathione-S-transferase)-CRS5 (metallothionein) + Ter1028Eric Holmes71164CompositeIn stock
BBa_K1460002RBS + GST (glutathione-S-transferase)-CRS5 (metallothionein) + Ter970Eric Holmes22913CompositeIn stock
BBa_K1460003Anderson Promoter + NixA + Ter1029Eric Holmes38921CompositeIn stock
BBa_K1460004Anderson Promoter + MerT + MerP + ter741Eric Holmes35221CompositeIn stock
BBa_K1404002Ptac-NiCoTB, improves nickel and cobalt internalization1306Alexandre Duprey50511GeneratorIn stock
BBa_K1355000Strong RBS + merA (mercuric ion reductase)+ terminator (BBa_ B0015) 1778Maria Clara Tavares Astolfi, Luna Barroco de Lacerda108272CompositeIn stock
BBa_K1355001Regulation and transport of mercury ions1189Maria Clara Tavares Astolfi, Luna Barroco de Lacerda222553GeneratorIn stock
BBa_K519011SmtA-Double Term.308Kotone Miyake20221CompositeIt's complicated
BBa_K1526007LacRS + MntH2676Cau Westmann2009 CompositeIt's complicated
BBa_K1980004pCusC promoter98Sam Garforth82891RegulatoryIt's complicated
BBa_K1980010pCopA TAT Csp1 sfGFP with divergent CueR1783Sam Garforth14674 OtherIt's complicated
BBa_K1980011pCopA MymT with divergent expressed CueR763Sam Garforth7770 DeviceIt's complicated
BBa_K1980012pCopA MymT sfGFP with divergent CueR1492Sam Garforth15585 DeviceIt's complicated
BBa_K2759003Bacterioferritin (BFR) with sfGFP conjugation1203Mehmet Ali Hoşkan3700 ConjugationIt's complicated
BBa_K1460005Anderson Promoter + RBS + CBP42189Eric Holmes38261CompositeNot in stock
BBa_K1460006Anderson Promoter + nixA + Ter + pT7 + GST-CRS5 + Ter2065Eric Holmes4477 CompositeNot in stock
BBa_K1460007Anderson Promoter + merT + merP + Ter + pT7 + GST-CRS5 + Ter1777Eric Holmes5614 CompositeNot in stock
BBa_K1460008Anderson Promoter + CBP4 + pT7 + GST-CRS5 + Ter3225Eric Holmes4501 CompositeNot in stock
BBa_K2737003constitutive promoter with fur box between -35 and -10 region78Xinyu Teng15541RegulatoryNot in stock
BBa_K2737004constitutive promoter with fur box downstream -10 region78Xinyu Teng15201RegulatoryNot in stock
BBa_K2737005constitutive promoter with fur box upstream -35 region84Xinyu Teng15131RegulatoryNot in stock


Metal Sensitive Promoters/Regulatory

This set includes promoters that are sensitive to various metals. The promoters are typically regulated by a receptor protein that binds to the metal ion or complex.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I721001Lead Promoter . . . gaaaaccttgtcaatgaagagcgatctatg944214It's complicated
BBa_I731004FecA promoter . . . ttctcgttcgactcatagctgaacacaaca90814Not in stock
BBa_I760005Cu-sensitive promoteratgacaaaattgtcat1612396Not in stock
BBa_I765000Fe promoter . . . accaatgctgggaacggccagggcacctaa10441233It's complicated
BBa_J3902PrFe (PI + PII rus operon) . . . tagatatgcctgaaagcgcataccgctatg2721250It's complicated
BBa_K1122069Ferric uptake repressor boxtgataatcattatca151508Not in stock
BBa_K1163101pAceB promoter region . . . gttttcggatccatgacgaggagctgcacg3002652Not in stock
BBa_K1163107Fes promoter region . . . atggcccggaatggcagcgtctgaatgacg2981891Not in stock
BBa_K1163110YncE promoter region . . . aaaaatatcggttcatcaaagggagtcgtc3001894Not in stock
BBa_K1342005zinTp (Cd2+ sensing promoter) (Fw:Lac promoter(-) ver.) . . . attacacatcatatacattaactctggagg811962In stock
BBa_K1509001A bi-directional promoter affected by SmtB protein . . . gttattcagatattcaaaggagttgctgtc1007742In stock
BBa_K1724000Pcada . . . tgactctgtagttgctacagggtgtgcaat315302In stock
BBa_K174016Promoterless ArsR binding siteagtaatcaaaataaattgatttattt261602Not in stock
BBa_K174017CadA promoter with CzrA binding site . . . aagctaagaggaggaactactatggctagc1711761Not in stock
BBa_K1980006pCopA with divergent expressed CueR . . . taacctttatcatactagaaagaggagaaa5746235It's complicated
BBa_K346002PmerT promoter (mercury-responsive) . . . gtacggaagtaaggttacgctatccaatcc5710001In stock
BBa_K346054PpbrA promoter . . . ctagagggtgttaaatcggcaacgcgagaa561461It's complicated
BBa_K540001rcn, cobalt-sensitive promoter . . . atcatgaccgaatttacaactcttcttcag4266785In stock
BBa_K896008zinTp (Cd2+ sensing promoter) . . . attacacatcatatacattaactctggagg812350In stock


Metal Sensitive Composite Parts

This set includes composite parts that are sensitive to various metals. These composite parts generally contain a metal sensitive promoter.


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K1460009Prcn + amilCP1101Eric Holmes1536 CompositeNot in stock
BBa_K1460010PmerT + amilCP732Eric Holmes1511 CompositeNot in stock
BBa_K1749000Cd sensitive promoter with Phi delta activator, PO promoter, and GFP1440Anne Byford1445 CompositeIt's complicated
BBa_K1755301copper promoter + RBS + ribB + terminator840Haotian Wang1716 MeasurementIt's complicated
BBa_K1755302copper promoter + RBS + ribB + terminator888Haotian Wang1650 MeasurementIt's complicated
BBa_K1755303cobalt sensor1243Haotian Wang1767 MeasurementIt's complicated
BBa_K1755305Hg Sensor841Haotian Wang1650 MeasurementIt's complicated
BBa_K1758312Chromium responsive promoter with UTR+RBS and sfGFP 1073Team Bielefeld-CeBiTec 201584382GeneratorIt's complicated
BBa_K1758313Chromium repressor under control of constitutive promoter and strong RBS,chromium responsive promote2081Team Bielefeld-CeBiTec 20156369 CompositeIt's complicated
BBa_K1758314Chromium responsive promoter under T7-promoter with UTR-sfGFP 1104Team Bielefeld-CeBiTec 20158525 CompositeIt's complicated
BBa_K1758321mRFP under control of copper responsive promoter770Team Bielefeld-CeBiTec 201528081GeneratorIn stock
BBa_K1758322Copper activator under control constitutive promoter and strong RBS and Copper responsive promoter w1247Team Bielefeld-CeBiTec 20151142 CompositeIt's complicated
BBa_K1758323UTR-sfGFP under control of Copper responsive promoter 992Team Bielefeld-CeBiTec 2015117683GeneratorIn stock
BBa_K1758325Copper responsive promoter with T7-promoter and UTR-sfGFP 1023Team Bielefeld-CeBiTec 201514374 CompositeIn stock
BBa_K1758331Lead responsive promoter with mRFP755Team Bielefeld-CeBiTec 201530011GeneratorIn stock
BBa_K1758332Lead responsive promoter with UTR-sfGFP 977Team Bielefeld-CeBiTec 201562602GeneratorIt's complicated
BBa_K1758333Lead repressor under control of constitutive promoter and strong RBS and lead responsive promoter wi1484Team Bielefeld-CeBiTec 20156647 CompositeIn stock
BBa_K1758334Lead responsive promoter with T7-promoter and UTR-sfGFP 1008Team Bielefeld-CeBiTec 20155893 CompositeNot in stock
BBa_K1758335UTR-sfGFP controlled by T7-promoter and lead responsive promoter786Team Bielefeld-CeBiTec 20152121 CompositeIn stock
BBa_K1758342Mercury responsive promoter with UTR-sfGFP 966Team Bielefeld-CeBiTec 2015123871GeneratorIt's complicated
BBa_K1758343MerR activator under constitutive promoter and induceble merT promoter with 5 UTR -sfGFP1470Team Bielefeld-CeBiTec 20159061 CompositeIn stock
BBa_K1758344Mercury responsive promoter with T7-promoter and UTR-sfGFP 989Team Bielefeld-CeBiTec 20157419 CompositeIt's complicated
BBa_K1758351Nickel responsive promoter with RFP791Team Bielefeld-CeBiTec 20152861 GeneratorIt's complicated
BBa_K1758352Nickel responsive promoter with UTR-sfGFP 1013Team Bielefeld-CeBiTec 201578102GeneratorIt's complicated
BBa_K1758353Nickel repressor under control of constitutive promoter and strong RBS and Nickel responsive promote1353Team Bielefeld-CeBiTec 20158282 GeneratorIt's complicated
BBa_K1758354 Nickel responsive promoter with T7-promoter and UTR-sfGFP1042Team Bielefeld-CeBiTec 20151587 CompositeNot in stock
BBa_K1980005pCopA sfGFP810Sam Garforth8288 ReporterIt's complicated
BBa_K1980007pCusC mKate2824Sam Garforth7793 ReporterIt's complicated
BBa_K1980008pCopA CueR sfGFP/ feedback pCopA sfGFP1252Sam Garforth9203 ReporterIt's complicated
BBa_K1980009pCusC CusR RFP1554Sam Garforth7938 ReporterIt's complicated
BBa_K1980010pCopA TAT Csp1 sfGFP with divergent CueR1783Sam Garforth14674 OtherIt's complicated
BBa_K1980011pCopA MymT with divergent expressed CueR763Sam Garforth7770 DeviceIt's complicated
BBa_K1980012pCopA MymT sfGFP with divergent CueR1492Sam Garforth15585 DeviceIt's complicated
BBa_K824008Cadmium Promoter with GFP Reporter 1068Steven Allen2289 CompositeIt's complicated
BBa_K824009Arsenic Promoter with GFP Reporter (Arsenic Detector)1381Steven Allen2339 CompositeIt's complicated
BBa_K824012Lead Promoter with GFP Reporter (Lead Detector)957Steven Allen2282 CompositeIt's complicated