Cell-cell signalling

< Back to Catalog

Promoters (?) Transcriptional regulators (?) Enzymes (?) Translational units (?) Composite parts

Promoters

These promoters are all related to cell signalling. Cell signalling is often mediated by a small molecule or peptide that diffuses between cells and can diffuse through cell membranes. The signalling molecule is recognized by a receptor protein (often located in or near the membrane of the cell) that regulates the activity of the promoters listed here directly, or via a signalling cascade.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I1051Lux cassette right promoter . . . tgttatagtcgaatacctctggcggtgata681735In stock
BBa_I14015P(Las) TetO . . . ttttggtacactccctatcagtgatagaga1701524In stock
BBa_I14016P(Las) CIO . . . ctttttggtacactacctctggcggtgata1681523In stock
BBa_I14017P(Rhl) . . . tacgcaagaaaatggtttgttatagtcgaa5113707In stock
BBa_I739105Double Promoter (LuxR/HSL, positive / cI, negative) . . . cgtgcgtgttgataacaccgtgcgtgttga993259Not in stock
BBa_I746104P2 promoter in agr operon from S. aureus . . . agattgtactaaatcgtataatgacagtga961753In stock
BBa_I751501plux-cI hybrid promoter . . . gtgttgatgcttttatcaccgccagtggta661222Not in stock
BBa_I751502plux-lac hybrid promoter . . . agtgtgtggaattgtgagcggataacaatt744200Not in stock
BBa_I761011CinR, CinL and glucose controlled promotor . . . acatcttaaaagttttagtatcatattcgt2952080It's complicated
BBa_J06403RhIR promoter repressible by CI . . . tacgcaagaaaatggtttgttatagtcgaa511464In stock
BBa_J102001Reverse Lux Promoter . . . tcttgcgtaaacctgtacgatcctacaggt551785It's complicated
BBa_J64000rhlI promoter . . . atcctcctttagtcttccccctcatgtgtg721470Not in stock
BBa_J64010lasI promoter . . . taaaattatgaaatttgcataaattcttca533970Not in stock
BBa_J64067LuxR+3OC6HSL independent R0065 . . . gtgttgactattttacctctggcggtgata981810Not in stock
BBa_J64712LasR/LasI Inducible & RHLR/RHLI repressible Promoter . . . gaaatctggcagtttttggtacacgaaagc1571866Not in stock
BBa_K091107pLux/cI Hybrid Promoter . . . acaccgtgcgtgttgatatagtcgaataaa574524It's complicated
BBa_K091117pLas promoter . . . aaaattatgaaatttgtataaattcttcag1263108It's complicated
BBa_K091143pLas/cI Hybrid Promoter . . . ggttctttttggtacctctggcggtgataa1641530It's complicated
BBa_K091146pLas/Lux Hybrid Promoter . . . tgtaggatcgtacaggtataaattcttcag1264661In stock
BBa_K091156pLux . . . caagaaaatggtttgttatagtcgaataaa551608Not in stock
BBa_K091157pLux/Las Hybrid Promoter . . . ctatctcatttgctagtatagtcgaataaa552254Not in stock
BBa_K145150Hybrid promoter: HSL-LuxR activated, P22 C2 repressed . . . tagtttataatttaagtgttctttaatttc662130It's complicated
BBa_K1520010Prlux-rbs-rfp-Ter . . . caccttcgggtgggcctttctgcgtttata9321622It's complicated
BBa_K1520515MC7-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter. . . . caccttcgggtgggcctttctgcgtttata36111361Not in stock
BBa_K1520516MC31-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter . . . caccttcgggtgggcctttctgcgtttata36101362Not in stock
BBa_K2558001lux pR-HS . . . caagaaaatggtttgttactttcgaataaa558939It's complicated
BBa_K266000PAI+LasR -> LuxI (AI) . . . caccttcgggtgggcctttctgcgtttata9632325It's complicated
BBa_K266005PAI+LasR -> LasI & AI+LuxR --| LasI . . . aataactctgatagtgctagtgtagatctc8191498It's complicated
BBa_K266006PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP . . . caccttcgggtgggcctttctgcgtttata17051471It's complicated
BBa_K266007Complex QS -> LuxI & LasI circuit . . . caccttcgggtgggcctttctgcgtttata26761513It's complicated
BBa_K658006position 3 mutated promoter lux pR-3 (luxR & HSL regulated) . . . caagaaaatggtttgttatagtcgaataaa553218Not in stock
BBa_K658007position 5 mutated promoter lux pR-5 (luxR & HSL regulated) . . . caagaaaatggtttgttatagtcgaataaa553170Not in stock
BBa_K658008position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) . . . caagaaaatggtttgttatagtcgaataaa553301Not in stock
BBa_R0062Promoter (luxR & HSL regulated -- lux pR) . . . caagaaaatggtttgttatagtcgaataaa5561847In stock
BBa_R0063Promoter (luxR & HSL regulated -- lux pL)
. . . cacgcaaaacttgcgacaaacaataggtaa1514614In stock
BBa_R0071Promoter (RhlR & C4-HSL regulated) . . . gttagctttcgaattggctaaaaagtgttc539591In stock
BBa_R0078Promoter (cinR and HSL regulated) . . . ccattctgctttccacgaacttgaaaacgc2252460In stock
BBa_R0079Promoter (LasR & PAI regulated) . . . ggccgcgggttctttttggtacacgaaagc15718233In stock
BBa_R1062Promoter, Standard (luxR and HSL regulated -- lux pR)
. . . aagaaaatggtttgttgatactcgaataaa562617In stock

Transcriptional regulators

Transcriptional regulators either activate or repress transcription from cognate promoters.


More...
NameProteinDescriptionTagDirectionUniprotKEGGOperatorLigandLength
BBa_C0062LuxRluxR repressor/activator, (no LVA?)NoneForwardP12746   781
BBa_C0071rhlR-LVArhlR repressor/activator from P. aeruginosa PA3477 (+LVA)LVAForwardP54292   787
BBa_C0079lasR-LVAlasR activator from P. aeruginosa PAO1(+LVA)LVAForwardP25084   781
BBa_C0077cinRcinR activator from Rhizobium leguminosarum (+LVA)LVAForward~ Q84HT2   787
BBa_C0171rhIRrhlR repressor/activator from P. aeruginosa PA3477 (no LVA)NoneForwardP54292   729
BBa_C0179lasRlasR activator from P. aeruginosa PAO1(no LVA)NoneForwardP25084   723
BBa_K082006 LuxR-G2F    753
BBa_S04301lasR-LVAC0079:B0015LVAForwardP25084   918
BBa_K266002lasR-LVALasR + TermLVAForwardP25084   918
BBa_K783054lasR-LVAThis is a MoClo converted version of BBa_C0079LVAForwardP25084   756
BBa_K131022 LuxO D47E, Vibrio harveyi    1362
BBa_K131023 LuxO D47A, Vibrio harveyi    1362
BBa_K2656016 LuxR TF Coding Sequence    757


Enzymes

< Back to Biosynthesis Protein coding sequences

N-Acyl Homoserine lactones (AHLs or N-AHLs) are a class of signaling molecules involved in bacterial quorum sensing. Quorum sensing is a method of communication between bacteria that enables the coordination of group based behavior based on population density. In synthetic biology, genetic parts derived from quorum sensing systems have been used to create patterns on a lawn of bacteria and to achieve synchronized cell behavior. AHL can diffuse across cell membranes and is stable in growth media over a range of pH values. AHL can bind to transcriptional activators such as LuxR and stimulate transcription from cognate promoters. Several similar quorum sensing systems exists across different bacterial species; thus, there are several known enzymes that synthesize or degrade different AHL molecules. Note that genetic parts derived from different quorum sensing systems may have different levels of crosstalk.

Biosynthesis


More...
NameProteinDescriptionDirectionUniprotKEGGE.C.SubstrateProductLengthStatus
BBa_C0061luxI-LVAautoinducer synthetase for AHLForwardP12747nonenone  643In stock
BBa_C0060aiiA-LVAautoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactoneForwardQ1WNZ5none3.1.1.-  814In stock
BBa_C0070rhlI-LVAautoinducer synthetase for N-butyryl-HSL (BHL) and HHLForwardQ02QW5nonenone  667In stock
BBa_C0076cinIautoinducer synthetaseForwardQ1MDW1nonenone  727In stock
BBa_C0078lasIautoinducer synthetase for PAI from Pseudomonas aeruginosaForwardP33883pae:PA1432none  667In stock
BBa_C0161luxIautoinducer synthetase for AHL (no LVA)ForwardP12747nonenone  585In stock
BBa_C0170rhIIautoinducer synthetase for N-butyryl-HSL (BHL) and HHL (no LVA)ForwardQ02QW5nonenone  609In stock
BBa_C0178lasIautoinducer synthetase for PAI from Pseudomonas aeruginosa (no LVA)ForwardP33883pae:PA1432none  609In stock
BBa_K091109 LuxS     516In stock
BBa_K2656019 LuxI Coding Sequence     586It's complicated


Degradation


More...
NameProteinDescriptionDirectionUniprotKEGGE.C.SubstrateProductLengthStatus
BBa_C0060aiiA-LVAautoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactoneForwardQ1WNZ5none3.1.1.-  814In stock
BBa_C0160aiiAautoinducer inactivation enzyme aiiA (no LVA)ForwardQ1WNZ5none3.1.1.-  756In stock


Translational units

Translational units begin with the RBS, the site of ribosome binding and translational initiation, and end with a stop codon, the site of translational termination. Every translational unit in the Registry consists of at least three parts, a Translational start, one or more Internal Domains including Special Internal Domains, and a Tail Domain. Thus translational units can, in some sense, be thought of as a composite part made up of three or more parts. Protein coding sequences, in contrast, begin with a start codon and end with a stop codon.

ProteinDomains.png

For more information on protein domains, see protein domains. Unfortunately, the original BioBrick assembly standard, Assembly standard 10, does not support in-frame assembly of protein domains. (Assembly standard 10 creates an 8 bp scar between adjacent parts.) Therefore, it is recommended that you use an alternate approach to assemble protein domains together to make a translational unit. There are several possible approaches to assembling protein domains including direct synthesis (preferred because it creates no scars) as well as various assembly standards. Regardless of which standard you choose, we suggest that the resulting translational unit comply with the original BioBrick assembly standard so that your parts can be assembled with most of the parts in the Registry.


Translational units should be as follows

GAATTC GCGGCCGC T TCTAGA G [RBS] [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG


Although most RBSs are currently specified as separate parts in the Registry, we are now moving to a new design in which the RBS and Head domain are combined into a single part termed a Translational start. The new design has the advantage of encapsulating both ribosome binding and translational initiation within a single part. Our working hypothesis is that the new design will reduce the likelihood of unexpected functional composition problems between the RBS and coding sequence.


More...
NameProteinDescriptionTagDirectionUniProtKEGGLengthStatus
BBa_I9026 rhlI translational unit  685In stock
BBa_C0261luxIAHL-making Enzyme, luxI (+RBS)LVAForward  661In stock
BBa_K081008 luxI protein generator (TERM-)  664In stock
BBa_K081009 lasI protein generator (TERM-)  688In stock
BBa_K081020 cI and lasR protein generator (TERM-)  1606In stock
BBa_K082010 B0034-C0070   685In stock
BBa_K332033 37℃ induced RBS + tetR + double terminator  864In stock
BBa_C0260aiiAautoinducer inactivation enzyme, AaiiA (+RBS)LVAForward  832It's complicated
BBa_J37033 RBS + LuxR  799It's complicated
BBa_K091138 RBS+lsrR  972It's complicated
BBa_K091158 RBS+lsrK  1611It's complicated
BBa_K131015 LuxPQ from Vibrio harveyi  3825It's complicated
BBa_K131016 LuxOU from Vibrio harveyi  1945It's complicated
BBa_K082007 B0030-C0070   688It's complicated
BBa_K082008 B0032-C0070   686It's complicated
BBa_K1631003 Tlanslational unit of Colicin Lysis Protein (for colicin-E3)  156It's complicated
BBa_K772001 EpCAM Binding Dock: C-terminus  1159Not in stock
BBa_K772002 EpCAM Binding Dock: N terminus  1138Not in stock
BBa_K1520501LuxRRbs-luxR(scarless)NoneForwardP12746 799Not in stock
BBa_K1520504luxI-LVARbs-luxI(scarless)LVAForwardP12747none661Not in stock
BBa_K1631002 Translational unit of Colicin-E3  1668Not in stock


Composite parts

These are composite parts related to cell-cell signalling.


More...
NameTypeDescriptionLengthStatus
BBa_F1610Signalling3OC6HSL Sender Device798In stock
BBa_F2620Signalling3OC6HSL -> PoPS Receiver1061In stock
BBa_F2621Signalling3OC6HSL Receiver Device1158In stock
BBa_F2622Signalling3OC6HSL Receiver Device1062In stock
BBa_I0424SignallingI0404.I61012700It's complicated
BBa_I0426SignallingI0406.I61072798It's complicated
BBa_I0428SignallingI0408.I61062872It's complicated
BBa_I0429SignallingI0408.I61162858Not in stock
BBa_I0460GeneratoraiiA Device (B0034.C0060.B0015)969It's complicated
BBa_I0462GeneratorluxR Protein Generator936In stock
BBa_I0464SignallingLasR Protein Generator936It's complicated
BBa_I0466SignallingRhlR Protein Generator942In stock
BBa_I0468SignallingCin R Protein Generator942Not in stock
BBa_I13018SignallingLuxR Cassette under Ptet (Other)998In stock
BBa_I13035Signalling3OC6HSL Receiver Device with Inducible Control of LuxR and a YFP Output device3003Not in stock
BBa_I13202Signalling3OC6HSL Sender Controlled by Lac Repressible Promoter803In stock
BBa_I13203SignallingpBad.aiiA protein generator (LVA-)2129Not in stock
BBa_I13205SignallingHSL/aiiA test construct4239Not in stock
BBa_I13206SignallingaiiA (LVA-) protein generator driven by ptet973Not in stock
BBa_I13207SignallingHSL/aiiA test construct4142In stock
BBa_I13208SignallingaiiA (LVA-) protein generator driven by plac974It's complicated
BBa_I13210SignallingLux/Cin Relaxation Oscillator5724Not in stock
BBa_I13211SignallingBiobricked version of the natural Lux quorum sensing system1964In stock
BBa_I13212SignallingLuxR Protein Generator Controlled by the Left Lux Promoter1095It's complicated
BBa_I13213SignallingBioBricked version of the natural Lux system with order reversed1964Not in stock
BBa_I13261SignallingLux Receiver (I13263 with reversed part order)2044In stock
BBa_I13262SignallingPoPS->PoPS Amplifier Controlled by 3OC6HSL999In stock
BBa_I13263SignallingLux Receiver (HSL & R0063 driven)2044In stock
BBa_I13264SignallingLux based Sender/Receiver/Reporter system2713Not in stock
BBa_I13265SignallingLux based Sender/Receiver/Reporter system (LVA-)2655Not in stock
BBa_I13266SignallingLux-based Sender/Receiver Device which outputs PoPS1827Not in stock
BBa_I13272SignallingYFP Producer Controlled by 3OC6HSL Receiver Device2083In stock
BBa_I13273SignallingYFP Producer Controlled by 3OC6HSL Receiver Device1947It's complicated
BBa_I13274SignallingLux Receiver (HSL & R0011 driven)1948Not in stock
BBa_I13277SignallingPoPS->PoPS amplifier (CinR-based, HSL driven)1175Not in stock
BBa_I1466SignallingRhlR protein generator (LVA-)884In stock
BBa_I1467SignallingAI-1 protein generator (LVA-)878Not in stock
BBa_I1468GeneratorCinR protein generator 884In stock
BBa_I534060SignallingaiiA Protein Generator (LVA+) Controlled by a tet Repressible Promoter2187Not in stock
BBa_I722006SignallingGFP Producer Controlled by 3OC6HSL (without Promoter)1885It's complicated
BBa_I722011Compositerhl producer followed by a AHL acceptor2702It's complicated
BBa_I722012CompositeAHL->RoPs and mRFP producer2722In stock
BBa_I724000DeviceAutoinducer inactivation enzyme regulated by LuxR/HSL promoter895It's complicated
BBa_I726031DeviceTrc-LIC1552It's complicated
BBa_I726041DeviceSen-TIC1551It's complicated
BBa_I726061DeviceTrc-LRY1748It's complicated
BBa_I726071DeviceRec-RRY1748It's complicated
BBa_I726081DeviceRec-LRY.RC2697It's complicated
BBa_I729004CompositeSensitive AHL Receiver1920It's complicated
BBa_I729005CompositeAHL Reporter and Quencher2650It's complicated
BBa_I729006CompositeAHL reporter and aiia device2985It's complicated
BBa_I732923DeviceI732907 I7329225682It's complicated
BBa_I751250GeneratorpSB4 plac-luxI803In stock
BBa_I751350GeneratorpBR322 plac-luxI803In stock
BBa_I761011RegulatoryCinR, CinL and glucose controlled promotor295It's complicated
BBa_J06001SignallingTet repressible luxI generator ( LVA+ )860In stock
BBa_J06002SignallingTet repressible luxI generator ( LVA- )802Not in stock
BBa_J06101SignallingTet repressible lasI generator ( LVA+ )884In stock
BBa_J06102SignallingTet repressible lasI generator ( LVA- )826Not in stock
BBa_J06201SignallingTet repressible rhI generator (LVA+)884In stock
BBa_J06400Signalling3OC12HSL Receiver1147Not in stock
BBa_J06401Signalling30C12HSL Sender764It's complicated
BBa_J06402SignallingC4HSL Receiver1044Not in stock
BBa_J07043SignallingJ07012.B0015 (scFv 4-4-20.TT)899It's complicated
BBa_J07044SignallingJ07013.B0015 (scFv S101A.TT)899It's complicated
BBa_J07045SignallingJ07014.B0015 (scFv 4M5.3.TT)899It's complicated
BBa_J13040SignallingpOmpR dependent 3OC6HSL sender device914In stock
BBa_J85120CompositeHigh Population->mRFP (pLac->LuxI; pLacIQ->luxR; pLux->mRFP;)2653Not in stock
BBa_K081011GeneratorluxR protein generator under Plambda regulation (TERM-)859In stock
BBa_K081015GeneratorluxI protein generator - PoPS->luxI711In stock
BBa_K081019GeneratorluxR protein generator under Plambda regulation906In stock
BBa_K082020GeneratorLuxR generator998In stock
BBa_K082021GeneratorRhlI generator1004It's complicated
BBa_K082023GeneratorB0034-C0070-B0015 822It's complicated
BBa_K082029GeneratorLuxI generator860In stock
BBa_K082030GeneratorluxI generator on PSB3C5860In stock
BBa_K082031CompositeR0071-B0030-C0070 749It's complicated
BBa_K082032CompositeR0071-B0032-C0070 747It's complicated
BBa_K082035GeneratorRhlI generator884In stock
BBa_K082036GeneratorLuxR & RhlI generator1890It's complicated
BBa_K082037GeneratorRhlI & GFP generator1633It's complicated
BBa_K091134DeviceLas Receiver with GFP reporter2048It's complicated
BBa_K091139GeneratorRBS+lsrR+TT1109It's complicated
BBa_K091182DevicepLasR/cI-RBS-LuxI-RBS-Mnt-TT-pMnt/tetR-RBS-LuxI-RBS-cI-TT2988It's complicated
BBa_K091190Deviceplux/cI+RBS+lasI+RBS+Mnt+TT+pMnt/lac+RBS+lasI+RBS+cI+TT2802It's complicated
BBa_K091203DevicepBAD-RBS-LuxR-RBS-LacI(I12)-TT2183It's complicated
BBa_K094103Deviceplux-rbs-cheZ-terminator878It's complicated
BBa_K094106DevicePlux-rbs-CI-terminator-plambda P(O-R12)-rbs-cheZ2521It's complicated
BBa_K094112DeviceluxR-luxI-terminator1552It's complicated
BBa_K1072002GeneratorNADH dehydrogenase1525It's complicated
BBa_K1072017CompositepGAL1 + Flag + odr-10 + GFP + ADH1Te + pFUS1 + BFP + ADH1Te4169Not in stock
BBa_K1072018CompositepGAL1 + Flag + Brho + odr-10 + GFP + ADH1Te + pFUS1 + BFP + ADH1Te4235Not in stock
BBa_K1157013CompositepCI-mCherry-pConst-RhlR-pRhl-RhlR-CI3627It's complicated
BBa_K116626GeneratorBBa_B0032 + LuxR + BBa_B0015937It's complicated
BBa_K1520003GeneratorPcons2-rbs-luxR-Ter979It's complicated
BBa_K1520009CompositePlac-rbs-luxI-Ter1006It's complicated
BBa_K1520010ReporterPrlux-rbs-rfp-Ter932It's complicated
BBa_K1520011CompositePrlux-rbs-rfp-rbs-luxI-Ter1601It's complicated
BBa_K1520012CompositePrlux-rbs-rfp-rbs-luxR-Ter1739Not in stock
BBa_K1520013CompositePrlux-rbs-rfp-rbs-luxI-rbs-luxR-Ter2408It's complicated
BBa_K1520019CompositePcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter2365It's complicated
BBa_K1520020CompositePcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter3352Not in stock
BBa_K1520021CompositePcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-Ter4292Not in stock
BBa_K1520022CompositePcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-rbs-luxI-Ter4961Not in stock
BBa_K1520023CompositePcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-rbs-luxR-Ter5099Not in stock
BBa_K1520024CompositePcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-rbs-luxI-rbs-luxR-Ter5768Not in stock
BBa_K1520508CompositePgolTS-golS-PgolB-rbs-luxI-Ter1559Not in stock
BBa_K1520510CompositePgolTS-golS-PgolB-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter4231Not in stock
BBa_K1520511CompositeMC7-rbs-luxI-Ter939Not in stock
BBa_K1520512CompositeMC31-rbs-luxI-Ter938Not in stock
BBa_K1520515CompositeMC7-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter.3611Not in stock
BBa_K1520516CompositeMC31-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter3610Not in stock
BBa_K1631022GeneratorPlux -rbs- Barnase -rbs- GFP -d.term1330It's complicated
BBa_K1631024DeviceColicin-E3 cassette (Strong)2290It's complicated
BBa_K1631025DeviceColicin-E3 cassette (Medium)2290It's complicated
BBa_K2637034CompositeKaiA cassette II with PGK1 Promoter and PGK1 Terminator1731It's complicated
BBa_K266000SignallingPAI+LasR -> LuxI (AI)963It's complicated
BBa_K266002CodingLasR + Term918In stock
BBa_K266005SignallingPAI+LasR -> LasI & AI+LuxR --| LasI819It's complicated
BBa_K266006SignallingPAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP1705It's complicated
BBa_K266007SignallingComplex QS -> LuxI & LasI circuit2676It's complicated
BBa_K332031GeneratorConstitutive promoter + 37℃ induced RBS + tetR + double terminator907It's complicated
BBa_K332032GeneratorConstitutive promoter+37℃ induced RBS+tetR+double terminator+Ptet+RBS+GFP+double terminator1836It's complicated
BBa_K546000SignallingLux pL controlled LuxR with lux pR autoinducing LuxI(lva tag)- AHL.1964In stock
BBa_K546001CompositeLux pL controlled luxR with lux pR controlled AHL degrading enzyme AiiA(lva tag). 2135In stock
BBa_K546002MeasurementLux pL controlled luxR with lux pR controlled GFP(lva tag).2080It's complicated
BBa_K546003SignallingLux pL controlled LuxR + lux pR promoter.1158In stock
BBa_K546005CompositeLux pL controlled LuxR + lux pR autoinducing LuxI (lva tag) + lux pR controlled GFP(lva tag).4052It's complicated
BBa_K574001SignallingTetR regulated by 3OC6HSL1890It's complicated
BBa_K574004Signalling3OC12HSL regulated by TetR797In stock
BBa_K574005Signalling3OC12HSL and YFP regulated by pBad1712In stock
BBa_K574006Device3OC12HSL regulated by pTet and pBad2517In stock
BBa_K574009Signalling3OC12HSL -> PoPS Receiver1147It's complicated
BBa_K772100ProjectEpCAM Detection Device2305It's complicated
BBa_K990001SignallingpOmpC+EPIC Firefly Luciferase2742It's complicated
BBa_S04301CodingC0079:B0015918In stock
BBa_T9001SignallingGFP and Producer Controlled by 3OC6HSL Receiver Device1946It's complicated
BBa_T9002SignallingGFP Producer Controlled by 3OC6HSL Receiver Device1945In stock


BarryCantonPhoto.jpg Barry Canton, as a graduate student in Drew Endy's lab, built and characterized the cell-cell signalling receiver BBa_F2620.