Bacteriophage T7

< Back to Catalog

The following is rewritten based on Chan, Kosuri and Endy, 2005 Chan.

Bacteriophage T7, an obligate lytic phage that infects Escherichia coli (Dunn and Studier, 1983; Studier and Dunn, 1983), offers an attractive model system for genome design and engineering for several reasons.

  • Genetics, and then biochemistry, enabled the discovery and characterization of some of the individual elements that participate in T7 development (Molineux, 2005).
  • Compared to other phage, T7 is relatively independent of complex host physiology. For example, the optical density of T7-infected cultures stops increasing at the time of infection. T7 encodes phage-specific RNA and DNA polymerases, and E. coli mRNA and protein synthesis is inhibited within the first 6 min of T7 infection.
  • RNA polymerase pulls most of the T7 genome into the newly infected cell (Zavriev and Shemyakin, 1982; Garcia and Molineux, 1995). Polymerase-mediated genome entry is a relatively slow process that results in the direct physical coupling of gene expression dynamics to gene position. For example, a gene cannot be expressed until its coding domain enters the newly infected cell.

Promoters (?) Primers (?)
Help: Want to know more about Bacteriophage T7? See the help pages for more information.

Promoters

Constitutive

ConstitutivePromoter.png

These promoters are recognized by the T7 RNA Polymerase and are constitutive meaning that their activity is dependent on the availability of RNA polymerase, but is not affected by any transcription factors. T7 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I712074T7 promoter (strong promoter from T7 bacteriophage) . . . agggaatacaagctacttgttctttttgca461938In stock
BBa_I719005T7 Promotertaatacgactcactatagggaga233372In stock
BBa_J34814T7 Promotergaatttaatacgactcactatagggaga281190Not in stock
BBa_J64997T7 consensus -10 and resttaatacgactcactatagg194210It's complicated
BBa_K113010overlapping T7 promoter . . . gagtcgtattaatacgactcactatagggg401553It's complicated
BBa_K113011more overlapping T7 promoter . . . agtgagtcgtactacgactcactatagggg371601It's complicated
BBa_K113012weaken overlapping T7 promoter . . . gagtcgtattaatacgactctctatagggg401630It's complicated
BBa_K1614000T7 promoter for expression of functional RNAtaatacgactcactatag181372In stock
BBa_R0085T7 Consensus Promoter Sequencetaatacgactcactatagggaga232072In stock
BBa_R0180T7 RNAP promoterttatacgactcactatagggaga231654Not in stock
BBa_R0181T7 RNAP promotergaatacgactcactatagggaga231651Not in stock
BBa_R0182T7 RNAP promotertaatacgtctcactatagggaga231653Not in stock
BBa_R0183T7 RNAP promotertcatacgactcactatagggaga231653Not in stock
BBa_Z0251T7 strong promoter . . . taatacgactcactatagggagaccacaac351887Not in stock
BBa_Z0252T7 weak binding and processivity . . . taattgaactcactaaagggagaccacagc351667Not in stock
BBa_Z0253T7 weak binding promoter . . . cgaagtaatacgactcactattagggaaga351400Not in stock


Repressible

NegativePromoter.png

All the promoters on this page are recognized by the T7 RNA Polymerase and are negatively regulated meaning that increased levels of at least one transcription factor will decrease the activity of these promoters. T7 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K921000T7 RNAP + IPTG->PoPs (Mutant I) . . . aggacaattgtgggcggacaacaattccaa466465In stock
BBa_K921001T7 RNAP + IPTG->PoPs (Mutant II) . . . ggcggaattgtgagcggataacaattccaa486782It's complicated
BBa_K921002T7 RNAP + IPTG->PoPs (Mutant III) . . . gagagaattgtgagcggataacaattccaa476400In stock
BBa_R0184T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441176Not in stock
BBa_R0185T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441888Not in stock
BBa_R0186T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441885Not in stock
BBa_R0187T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441885Not in stock


Primers


More...
NameDescriptionSequenceDirectionTarget%GCTmLength
BBa_G00113T7 promoter sequencing primer, 20-mertaatacgactcactatagggF 40 56C20


References

<biblio>

  1. Dunn pmid=6864790
  2. Studier79a pmid=375582
  3. Studier79b pmid=231684
  4. Studier81 pmid=7338920
  5. Chan pmid=16729055

</biblio>