Bacillus subtilis

< Back to Catalog
This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.
Bacillus subtilis is gram-positive model organism. Thus, much is known about this organism. The genome of Bacillus subtilis strain 168 has been sequenced.

Although the current part collection for B. subtilis is small, many are now using B. subtilis as a candidate host for synthetic devices and systems. Please read more about the advantages and disadvantages of using B. subtilis as a chassis.

Plasmid backbones (?) Promoters (?) Ribosome binding sites (?)
Protein coding sequences (?) DNA parts (?)
Help: Want to know more about Bacillus subtilis? See the help pages for more information.

Previous iGEM Bacillus subtilis Projects

Team Year Parts Project Title
DTU-Denmark 2015 Parts The Synthesizer: Development of antibiotic libraries through Multiplex Automated Genome Engineering
Groningen 2015 Parts Blue Bio Energy
Nagahama 2015 Parts ''香蔵庫'' Flavorator: New food preservation method by rose odor E. coli
Nanjing-China 2015 Parts Metallosniper: —innovative total solution for heavy metals
NEFU_China 2015 Parts Yogurt Guarder
Stanford-Brown 2015 Parts biOrigami: A New Approach to Reduce the Cost of Space Missions
Technion_Israel 2015 Parts Be Bold: Hit baldness at its root
TJU 2015 Parts Power Consortia
Purdue 2014 Parts Minecrobe: Bacillus subtilis Production of Corn Phytosiderophores to Combat Malnutrition
LA Biohackers 2014 Parts Boot up a Genome
Calgary 2014 Parts B.s. Detector – A Multiplexed Diagnostic Device
LMU-Munich 2014 Parts „BaKillus“ – Engineering a pathogen-hunting microbe
Paris Bettencourt 2014 Parts The smell of us
Toulouse 2014 Parts Let’s save our trees with SubtiTree!
HZAU-China 2013 Parts Safe moving vaccine factory
Groningen 2013 Parts Engineering Bacillus subtilis to self-assemble into a biofilm that coats medical implants with spider silk.
Hong_Kong_CUHK 2013 Parts Switch off PAHs
USTC_CHINA 2013 Parts T-VACCINE
Edinburgh 2013 Parts WastED
METU_Turkey 2013 Parts Bee subtilis
Newcastle 2013 Parts L-forms: Bacteria without a cell wall - a novel chassis for synthetic biology
UChicago 2013 Parts Keratinase Expression System in E. coli and B. subtilis
UNITN-Trento 2013 Parts B. fruity
UNAM_Genomics_Mexico 2012 Parts Bacillus booleanus
LMU-Munich 2012 Parts Beadzillus: Fundamental BioBricks for Bacillus subtilis and spores as a platform for protein display
Cambridge 2012 Parts Parts for a reliable and field ready biosensing platform
Groningen 2012 Parts The Food Warden. It’s rotten and you know it!
Warsaw 2012 Parts B. subtilis: supporting actor of the iGEM stage
HKUST-Hong_Kong 2012 Parts B. hercules---The Terminator of Colon Cancer
GeorgiaTech 2011 Parts De Novo Adaptation of Streptococcus thermophilus CRISPR1 Defense in Bacillus Subtilis
Newcastle 2010 Parts BacillaFilla: Filling Microcracks in Concrete
Groningen 2010 Parts Hydrophobofilm --- a self assembling hydrophobic biofilm
Imperial_College_London 2010 Parts Parasight – Parasite detection with a rapid response
Cornell 2009 Parts Engineering the Bacillus Subtilis Metal Ion Homeostasis System to Serve as a Cadmium Responsive Biosensor
Newcastle 2009 Parts Bac-man: sequestering cadmium into Bacillus spores
Imperial_College 2008 Parts Designer Genes – Biofabricator subtilis
Cambridge 2008 Parts Cambridge iBrain: Foundations for an Artificial Nervous System using Self-Organizing Electrical Patterning
Newcastle_University 2008 Parts A Computational Intelligence Approach to Developing a Diagnostic Biosensor: The Newcastle BugBusters Project


Plasmid backbone

BioBrickbackbonevspart.png

Plasmids are circular, double-stranded DNA molecules typically containing a few thousand base pairs that replicate within the cell independently of the chromosomal DNA. Plasmid DNA is easily purified from cells, manipulated using common lab techniques and incorporated into cells. Most BioBrick parts in the Registry are maintained and propagated on plasmids. Thus, construction of BioBrick parts, devices and systems usually requires working with plasmids.

Note: In the Registry, plasmids are made up of two distinct components:

  1. the BioBrick part, device or system that is located in the BioBrick cloning site, between (and excluding) the BioBrick prefix and suffix.
  2. the plasmid backbone which propagates the BioBrick part. The plasmid backbone is defined as the sequence beginning with the BioBrick suffix, including the replication origin and antibiotic resistance marker, and ending with the BioBrick prefix. [Note that the plasmid backbone itself can be composed of BioBrick parts.]

Many BioBrick parts in the Registry are maintained on more than one plasmid backbone!


The plasmids for B. Subtilis you can find in the registry are usually not built as standard registry plasmid so far. They come from third parties sources, that have been biobricked. Hence, these plasmid are often not silent. Cloning inside often works in different conditions than with standard E. coli plasmids. You may need to optimize again your ligation conditions.

As a particular drawback we noticed using replicative plasmids, is that they are often subject to recombination. We invite you to read in detail the experiment done and the peer review page before choosing a plasmid and a strategy.

There are 2 main kind of plasmids for B. Subtilis:

  • Replicative or also called episomal plasmids, are the same kind of plasmid with a replication origin and a resistance gene we are used to work with in E. Coli. These plasmids are often made to be multihost, so that they can be cloned using E. Coli and then the miniprep can be transformed into B. subtilis by starvation or electroporation. (Note that some replicative plasmids requires to be transformed into RecA+ E. Coli strains first before incorporating by starvation)
  • Integration plasmids is the most used technique by specialist in B. subtilis. They are E. Coli plasmids with two homologous sequence with two fragments of a chromosomal gene of B. Subtilis, and a resistance cassette inserted in between. If your brick is cloned in between these two homologous region, the vector act as a shuttle that integrate your construct into the chromosome.


Note that you should check your backbone and biobrick part sequence whether more than one side can be cut by same enzyme.You should not use if it has more than one same restriction enzyme site.

If you always see same bands in every gel images as different bp length from part page, you can try to transform your plasmid. Make sure that antibiotic you will use matches with which the backbone has..

And also if you see another band too, always at the same place and since first run. You can try transform your plasmid and check the viability when you exclude the possibility of contamination or any other things which can cause this problem in your lab. Another possibility could be that the part itself has already additional contaminated DNAs.



More...
NameDescriptionResistanceRepliconCopy
number
ChassisLength
BBa_I742123Multi-host vector pTG262 converted to BioBrick vectorCMulti-host Multi-host5564
BBa_J179000pBS1C: Bacillus subtilis vector, amyE integration, CAM-resistanceA(E. coli) C(B. subtilis)  B. subtilis + E. coli6105
BBa_J179001pBS2E: Bacillus subtilis vector, lacA integration, MLS resistanceA(E. coli) E(B. subtilis)  B. subtilis + E. coli6258
BBa_J179002pBs4S: Bacillus subtilis vector, thrC integration, spec resistanceA(E. coli) S(B. subtilis)pDG1731integrative in B. subtilisB. subtilis + E. coli4573
BBa_K090402B. subtilis Episomal Vector with Constitutive GFP     6337
BBa_K090403Gram-positive Shuttle Vector for Chromosomal Integration    5632
BBa_K1065204Efe+Bba_B0015 in BBa_K823024 (pXyl) A(E. coli) S(B. subtilis)  B. subtilis + E. coli6017
BBa_K1085014pSB1AC3-HySp: Integrational backbone into B. subtilis amyE locus with IPTG inducible promoter    7625
BBa_K1185004Integration vector for Bacillus subtilis derived from pSac-CmACmulti-host multi-host5210
BBa_K1364021Integrative plasmid for Bacillus subtilis (pSBbs4E)    5760
BBa_K818000Integration vector for Bacillus subtilis derived from pSac-CmACMulti host Multi host5223
BBa_K823021pSBBs1C-lacZ (lacZ reporter vector for B. subtilis)A(E. coli) C(B. subtilis)pAC6integrative in B. subtilisE.coli and B. subtilis9792
BBa_K823022pSBBs4S: Empty backbone for integration into Bacillus subtilis thrC locusA(E. coli) S(B. subtilis)pDG1731integrative in B. subtilisB. subtilis + E. coli4573
BBa_K823023pSBBs1C: Empty backbone for integration into Bacillus subtilis amyE locusA(E. coli) C(B. subtilis)  B. subtilis + E. coli6105
BBa_K823024pSBBs4S-Pxyl: Integrative expression vector for Bacillus subtilisA(E. coli) S(B. subtilis)  B. subtilis + E. coli4794
BBa_K823025pSBBs3C-luxABCDE (lux reporter vector for B.subtilis)A(E. coli) + C(B. subtilis)pAH328integrative in B. subtilisB. subtilis + E. coli10640
BBa_K823027pSBBs2E: Empty backbone for integration into Bacillus subtilis lacA locusA(E. coli) E(B. subtilis)  B. subtilis + E. coli6193

Constitutive promoters

ConstitutivePromoter.png

The promoters here are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.

The sequence of these promoter are adapted to the σ factor of B. subtilis. However, some of these promoter also works in E. coli. Generally speaking, standard E. coli promoters don't work (or are very weak) in B. subtilis strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both E. coli and B. subtilis strains - Contribution from User: Cyrpaut (31 October 2011)

Constitutive B. subtilis σA promoters

This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143012Promoter veg a constitutive promoter for B. subtilis . . . aaaaatgggctcgtgttgtacaataaatgt971796In stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa561603Not in stock
BBa_K780003Strong constitutive promoter for Bacillus subtilis . . . aattgcagtaggcatgacaaaatggactca36790It's complicated
BBa_K823000PliaG . . . caagcttttcctttataatagaatgaatga1216420In stock
BBa_K823002PlepA . . . tctaagctagtgtattttgcgtttaatagt1576562In stock
BBa_K823003Pveg . . . aatgggctcgtgttgtacaataaatgtagt2373992In stock

Constitutive B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143010Promoter ctc for B. subtilis . . . atccttatcgttatgggtattgtttgtaat561907Not in stock
BBa_K143011Promoter gsiB for B. subtilis . . . taaaagaattgtgagcgggaatacaacaac381864Not in stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa561603Not in stock

Positively regulated promoters

PositivePromoter.png

The B. subtilis promoters of this section is the ones that are said to be positively regulated. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details.

Positively regulated B. subtilis σA promoters

This section lists the promoters recognized by B. subtilis σA RNA polymerase sub-unit. σA is the major B. subtilis sigma factor that is present under most growth conditions (but maximal during exponential growth phase).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K090504Gram-Positive Strong Constitutive Promoter . . . acatgggaaaactgtatgtatttgatcctc2391309It's complicated

Positively regulated B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNA polymerase. σB is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions.


There are no parts for this table

Repressible promoters

NegativePromoter.png

The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI E. coli promoter.

In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a σA type contitutive promoter.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K090501Gram-Positive IPTG-Inducible Promoter . . . tggaattgtgagcggataacaattaagctt1071084It's complicated
BBa_K143014Promoter Xyl for B.subtilis . . . agtttgtttaaacaacaaactaataggtga821344Not in stock
BBa_K143015Promoter hyper-spank for B. subtilis . . . aatgtgtgtaattgtgagcggataacaatt1011482Not in stock


In the future, we may also find promoters builded with the σB promoter.


There are no parts for this table

Ribosome binding sites

B. subtilis have the same system of RBS than E. coli to drive its transcription. Hoever, the RBS sequences are not always compatible since B. subtilis ribsomomal RNA (rRNA) is slightly different in sequence compare to E. coli.

In this list, you can find the most common RBSs usually use in B. subtilis. They are classified by strengh in a qualitative manner, since no strengh reference ranking have been established for B. subtilis yet. It is not obvious to transport directly the system for E. coli since we need to have a promoter that is exactly the same strengh as an E. coli one to make both scales comparable between the organism.

We can also notice that E. coli RBSs usually doesn't works for B. subtilis, but it is not rare to find B. subtilis RBSs that works fine in E. coli (the SpoVg RBS for instance).

Please go in the description of each parts for more information.


More...
NameSequenceDescriptionRelative
Strength
Predicted
Strength
BBa_K090505aaaggaggtgt''Bacillus subtilis'' consensus RBS  
BBa_K090506agaggtggtgt''Bacillus subtilis'' weak RBS  
BBa_K104003agggggccgRBS_spaR  
BBa_K104005ggggcgttgRBS_spaK  
BBa_K104009agaggaggRBS_gfp  
BBa_K1351028aaggagggataLMU Bacillus RBS collection 1  
BBa_K1351029agaggaggataLMU Bacillus RBS collection 2  
BBa_K1351030aaggagagataLMU Bacillus RBS collection 3  
BBa_K1351031aggagaggataLMU Bacillus RBS collection 4  
BBa_K1351032aagaggagataLMU Bacillus RBS collection 5  
BBa_K1351033agaaagggataLMU Bacillus RBS collection 6  
BBa_K1351034aagaagagataLMU Bacillus RBS collection 7  
BBa_K143020taaaggaggaaGsiB ribosome binding site (RBS) for B. subtilis  
BBa_K143021aaaggtggtgaaSpoVG ribosome binding site (RBS) for B. subtilis  
BBa_K780001atattaagaggaggagStrong RBS for Bacillus Subtilis  
BBa_K780002agagaacaaggaggggStrong RBS for Bacillus Subtilis  

Protein coding sequences

Protein coding sequences are DNA sequences that are transcribed into mRNA and in which the corresponding mRNA molecules are translated into a polypeptide chain. Every three nucleotides, termed a codon, in a protein coding sequence encodes 1 amino acid in the polypeptide chain. In some cases, different chassis may either map a given codon to a different sequence or may use different codons more or less frequently. Therefore some protein coding sequences may be optimized for use in a particular chassis.

In the Registry, protein coding sequences begin with a start codon (usually ATG) and end with a stop codon (usually with a double stop codon TAA TAA). Protein coding sequences are often abbreviated with the acronym CDS.

Although protein coding sequences are often considered to be basic parts, in fact proteins coding sequences can themselves be composed of one or more regions, called protein domains. Thus, a protein coding sequence could either be entered as a basic part or as a composite part of two or more protein domains.

  1. The N-terminal domain of a protein coding sequence is special in a number of ways. First, it always contains a start codon, spaced at an appropriate distance from a ribosomal binding site. Second, many coding regions have special features at the N terminus, such as protein export tags and lipoprotein cleavage and attachment tags. These occur at the beginning of a coding region, and therefore are termed Head domains.
  2. A protein domain is a sequence of amino acids which fold relatively independently and which are evolutionarily shuffled as a unit among different protein coding regions. The DNA sequence of such domains must maintain in-frame translation, and thus is a multiple of three bases. Since these protein domains are within a protein coding sequence, they are called Internal domains. Certain Internal domains have particular functions in protein cleavage or splicing and are termed Special Internal domains.
  3. Similarly, the C-terminal domain of a protein is special, containing at least a stop codon. Other special features, such as degradation tags, are also required to be at the extreme C-terminus. Again, these domains cannot function when internal to a coding region, and are termed Tail domains.

For more details on protein domains including how to assemble protein domains into protein coding sequences, please see Protein domains.


Protein coding sequences should be as follows

GAATTC GCGGCCGC T TCTAG [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG


Note of the codon availability in B. subtilis: B. subtilis is more codon tolerent than E. coli, which means that you can generally express any protein from E. coli into B. subtilis without any problem. However, some proteins are said to be for subtilis for two reasons: One is because they comes from B. subtilis genome, (which means that you may have trouble in expressing them in E. coli) or because they are made to trigger a certain effect in B. subtilis (for instance kill it).



More...
NameProteinDescriptionTagDirectionUniProtKEGGLengthStatus
BBa_E0040GFPmut3b green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212NoneForward  720In stock
BBa_E1010mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral)NoneForward  706In stock
BBa_K104004 spaR CDS (Coding sequence)  663Not in stock
BBa_K104006 spaK CDS (Coding Sequence)  1182Not in stock
BBa_K1085000 RBS Start-codon Strep-tag SpiderSilkSubunitE1  268In stock
BBa_K1085001 RBS Start-codon SpiderSilkSubunitE1   226In stock
BBa_K1085002 SpiderSilkSubunitE2  210In stock
BBa_K1085003 SpiderSilkSubunitE2 Strep-tag   252In stock
BBa_K1085004 RBS Start-codon SpiderSilkSubunitN1 Strep-tag  199In stock
BBa_K1085005 RBS Start-codon SpiderSilkSubunitN1   157In stock
BBa_K1085006 SpiderSilkSubunitN2   129In stock
BBa_K1085007 SpiderSilkSubunitN2 Strep-tag  171In stock
BBa_K1085010 RBS Start-codon EstA Strep-tag SpiderSilkSubunitE1   907It's complicated
BBa_K1085012 RBS Start-codon EstA Strep-tag SpiderSilkSubunitN1   838In stock
BBa_K1085029 FliZ Strep-tag SpiderSilkSubunitE1  339In stock
BBa_K1085034 MotB Strep-tag SilkSubunitN1  309In stock
BBa_K1085050 des knock out  3604Not in stock
BBa_K1122000 SinR transcription factor  333It's complicated
BBa_K1122666 Ferric uptake repressor  450It's complicated
BBa_K1351000 beta-Neurexin-derived peptide binding to S. aureus adhesin SdrC  33In stock
BBa_K1351001 Contactin-4-derived peptide binding to NADH Oxidase of S. pneumoniae   42In stock
BBa_K1351002 Chondroitin 4 sulfotransferase-derived peptide binding to NADH Oxidase of S. pneumoniae   39In stock
BBa_K1351003 Laminin-derived peptide binding to NADH Oxidase of S. pneumoniae   27In stock
BBa_K1351006 CWB domain of B. subtilis major autolysin LytC  999In stock
BBa_K1351007 CWB domain of B. subtilis minor autolysin LytE  621In stock
BBa_K1351008 Signal peptide of B. subtilis endonuclease YhcR  138In stock
BBa_K1351010 Cell wall-anchoring domain of B. subtilis endonuclease YhcR  402In stock
BBa_K1351011 Bacillus subtilis sortase YhcS  597In stock
BBa_K1351012 spaS Subtilin (antimicrobial peptide, Freiburg standard)  168In stock
BBa_K1351013 spaS Subtilin (antimicrobial peptide)  171In stock
BBa_K1351017 SdpI with RBS: Immunity against the cannibalsim toxin sdpC of B. subtilis  333In stock
BBa_K1351021 Monomeric Red Fluorescent Protein from Discosoma striata  675In stock
BBa_K1351026 Signal peptide of B. subtilis major autolysin LytC  75In stock
BBa_K1351027 Signal peptide of B. subtilis minor autolysin LytE  75In stock
BBa_K1362461mRFP1**highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) with barcode NoneForward  706Not in stock
BBa_K1399000mRFP1RFP from Discosoma striata (coral) with AAV-ssrA degradation tagSsrA-AAVForward  714In stock
BBa_K1399001mRFP1RFP from Discosoma striata (coral) with LVA-ssrA degradation tagSsrA-LVA degradation tagForward  714In stock
BBa_K1399002mRFP1RFP from Discosoma striata (coral) with LAA-ssrA degradation tag (wt)SsrA-LAA degradation tagForward  714In stock
BBa_K1399003mRFP1RFP from Discosoma striata (coral) with DAS-ssrA degradation tagSsrA-DAS degradation tagForward  714In stock
BBa_K1399004GFPmut3bGFP (mut3b) with LVA-ssrA degradation tagSsrA-LVA degradation tagForward  753In stock
BBa_K1399005GFPmut3bGFP (mut3b) with AAV-ssrA degradation tagSsrA-AAV degradation tagForward  753In stock
BBa_K1399006GFPmut3bGFP (mut3b) with LAA-ssrA degradation tagSsrA-LAA degradation tagForward  753In stock
BBa_K1399007GFPmut3bGFP (mut3b) with SsrA-DAS+2 degradation tagSsrA-DAS+2 degradation tagForward  759In stock
BBa_K1399008GFPmut3bGFP (mut3b) with DAS-ssrA degradation tagSsrA-DAS degradation tagForward  753In stock
BBa_K143032 EpsE Molecular Clutch Gene of B. subtilis  840In stock
BBa_K143034 LipA-EAK16-II Fusion Protein  156It's complicated
BBa_K143035 LipA-Human Elastin (EP20-24-24) Fusion Protein  705It's complicated
BBa_K143036 Xylose operon regulatory protein  1056It's complicated
BBa_K143037 YtvA Blue Light Receptor for B.subtilis  789It's complicated
BBa_K143038 SacB-EAK16-II Fusion Protein  150It's complicated
BBa_K143039 SacB-Human Elastin (EP20-24-24) Fusion Protein  699It's complicated
BBa_K143063 Xylose operon repressor protein - Terminator  1193Not in stock
BBa_K1701000 GolB  195 
BBa_K1701001 PbrR  438Not in stock
BBa_K1701004 SUP  267 
BBa_K1701005 TasA  786 
BBa_K1701006 CotC  201 
BBa_K174012 sleB, Bacillus subtilis germination gene with RBS  932It's complicated
BBa_K2057002 Alginate lyase from Bacillus thuringiensis    
BBa_K294055GFPmut3bGFP RFP HybridNone  720In stock
BBa_K302001 yneA coding sequence  321Not in stock
BBa_K302006 spaI  498Not in stock
BBa_K302007 spaF  744Not in stock
BBa_K302008 spaE  756Not in stock
BBa_K302010 sfp  678Not in stock
BBa_K302011 swrA  432Not in stock
BBa_K302033 mazF  339In stock
BBa_K802006 Surfactin generator for B. subtilis  787Not in stock
BBa_K802007 Biofilm repressor for B. subtilis strains  304It's complicated
BBa_K802008 Transcriptional Bacillus regulator lacI  1193Not in stock
BBa_K802009 Sufactin generator and biofilm repressor for B. subtilis  2300It's complicated
BBa_K823020catchloramphenicol acetyltransferase (cat)  645It's complicated
BBa_K823031 cotZ: B. subtilis spore crust protein (-2aa)  435It's complicated
BBa_K823032 cotZ: B. subtilis spore crust protein  441It's complicated
BBa_K863121GFPmut3bgreen fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (His-tag)His6  750Not in stock


DNA parts for building integration vector

Any E. coli plasmid can be converted into an integration vector if one add two pieces of a a gene sequence that is homologous to a gene into B. subtilis genes, and an antibiotic resistance cassette or other screening method.

IntegrationAmyE.PNG
The AmyE integration DNA parts (BBa_K143001 and BBa_K143002) are two parts that can be added to the 5' and 3' ends of a construct to allow integration into the B. subtilis genome. These parts have been successfully used within the parts BBa_K143079 and BBa_K143082 for integration. Integrated synthetic biological systems offer better genetic stability and more regulated copy number than plasmid-borne systems. For more information about these parts, please see 2008 Imperial College iGEM team wiki.


More...
NameDescriptionSequenceLength
BBa_K1430015 Integration Sequence for the amyE locus of B. subtilis . . . aacacacaaattaaaaactggtctgatcga522
BBa_K1430023 Integration Sequence for the amyE locus of B. subtilis . . . tcgggcttaagcggttctcttccccattga1002

References

Given the number of available articles on B. subtilis, we only include some review articles here.

<biblio>

  1. Earl pmid=18467096
  2. Pavlendova pmid=18450217
  3. Sonenshein pmid=17982469
  4. Lopez pmid=17981078
  5. Aguilar pmid=17977783
  6. Irnov pmid=17381303

</biblio>