Assembly standard 15

< Back to Catalog

Bioscaffold sites are BioBrick parts that contain restriction enzyme recognition sites that enable full or partial removal of the Bioscaffold site from a composite BioBrick part. Bioscaffold parts address some of the limitations of BioBrick standard assembly by enabling protein fusions, cloning of part libraries within a composite BioBrick part, and removal of BioBrick scars.

Help: Want to know more about Assembly standard 15 (the BioScaffold standard)? See the help pages for more information.


More...
NameDescriptionSequenceLength
BBa_J70010A BioScaffold Part (Uses PpiI), for offset see Part Design page . . . taattaattaaacctggtgaacgtggtctc53
BBa_J70012A BioScaffold Part (Uses PsrI), Protein Head Remover see Part Design page . . . gcgccggcgcgccagctggtgaacaccagg52
BBa_J70030A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page . . . taattaattaaaccaggtgaacgtggtctc48
BBa_J70032A Composite BioScaffold Part (PpiI and PsrI) for Protein Fusions (see Design Page) . . . gcgccggcgcgccagctggtgaacaccagg138
BBa_J70034A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page) . . . gagtcccgggagctggaactcccacctgca45
BBa_J70036A BioScaffold Part (Uses AarI) for Library Insert Preparation (see Part Design page) . . . tcccgggagctggaactcccacctgcatat51
BBa_J70040A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) . . . gggtcccgggagcaccaggtcccacctgca45
BBa_J70050Left Library Insert Preparation Part (To use with J70052, and J70040)cacctgcatat11
BBa_J70052Right Library Insert Preparation Part (To use with J70050, and J70040)atagcaggtg10
BBa_K259002BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ctagctcctcagtggcagcggtgaggaggc88
BBa_K259004BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . tatgtaagtagtaacaagtagcgtggggca81
BBa_K259008BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ggtatgtaagtagtacaagtagcgtggggc79
BBa_K259009BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . atgtaagtagtaacaagtagcgtggggcag82
BBa_K606026tetO Array . . . tctatcactgatagggacccccaactctgt3628


JulieNorvillePhoto.jpg
Julie Norville, as a graduate student in Tom Knight and Angie Belcher's lab at MIT, developed a new set of DNA parts called Bioscaffold sites. Bioscaffold sites can be assembled as regular BioBrick parts, but enable you to remove BioBrick scars, create protein fusions, and insert part libraries within composite parts.

References

  1. BioBricks Foundation RFC 15 by Julie Norville, Angie Belcher and Tom Knight